D12Mit34 Primer Detail MGI Mouse MGI:706759

D12Mit34 Primer Detail

Name

D12Mit34
Primer 1 Sequence

GACCACCAGGGCTATTACACA
Primer 2 Sequence

TGCCAATCTTCACTCATGTACC
ID

MGI:706759
Product Size

171
Other IDs

D12Mit34 (BROAD)
Note

MIT assay: B176
Additional information: MIT STS Marker Data Files

D12Mit34

DNA segment, Chr 12, Massachusetts Institute of Technology 34

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D12Mit34	b	smaller	C57BL/6J
	D12Mit34	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D12Mit34	a	160bp	SPRET/EiJ
	b	172bp	CAST/EiJ
	c	174bp	B6.Cg-Lep^ob/+, C57BL/6J
	d	186bp	AKR/J, LP/J, NOD/MrkTac
	e	188bp	A/J, BALB/cJ, C3H/HeJ, DBA/2J

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24