D12Mit36 Primer Detail MGI Mouse MGI:706761

D12Mit36 Primer Detail

Name

D12Mit36
Primer 1 Sequence

CATCACACCAGGTTTAGAATTTT
Primer 2 Sequence

AGGCACTCTTCTGACCTCCA
ID

MGI:706761
Product Size

119
Other IDs

D12Mit36 (BROAD)
Note

MIT assay: B297
Additional information: MIT STS Marker Data Files

D12Mit36

DNA segment, Chr 12, Massachusetts Institute of Technology 36

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D12Mit36	c	larger	C3HeB/FeJLe
	D12Mit36	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D12Mit36	a	96bp	SPRET/EiJ
	b	104bp	CAST/EiJ
	c	120bp	NON/ShiLt
	d	122bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J
	e	128bp	NOD/MrkTac
	f	136bp	A/J, BALB/cJ, DBA/2J, LP/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D12Mit36	a	136bp	A.CA/W, BALB/cW, BN/aW, C3H/W, CBA/W, DBA/2W
	D12Mit36	b	122bp	129/SvW, AKR/W, C57BL/6W, C57BL/10W

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24