About   Help   FAQ
D1Mit24 Primer Detail
Primers
  • Name
    D1Mit24
  • Primer 1 Sequence
    CCAATCCATCTTGGGCAG
  • Primer 2 Sequence
    ATTGGTTTTGCTGAACCAGG
  • ID
    MGI:706764
  • Product Size
    202
  • Other IDs
    D1Mit24 (BROAD)
  • Note
    MIT assay: B151
    Additional information: MIT STS Marker Data Files
Genes
D1Mit24 DNA segment, Chr 1, Massachusetts Institute of Technology 24
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D1Mit24 a 166bp SPRET/EiJ
b 188bp CAST/EiJ
c 192bp NOD/MrkTac
d 202bp A/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J
e 210bp LP/J
f 216bp NON/ShiLt
g 218bp AKR/J, DBA/2J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D1Mit24 c 202bp CBA/CaOlaHsd
s 204bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
06/12/2024
MGI 6.13 		The Jackson Laboratory