D1Mit70 Primer Detail MGI Mouse MGI:706775

D1Mit70 Primer Detail

Name

D1Mit70
Primer 1 Sequence

CCAAGTCAAGTCATCATATGATTT
Primer 2 Sequence

CCTGTGTGCCCTGCTTAATT
ID

MGI:706775
Product Size

181
Other IDs

D1Mit70 (BROAD)
Note

MIT assay: MPC284
Additional information: MIT STS Marker Data Files

D1Mit70

DNA segment, Chr 1, Massachusetts Institute of Technology 70

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D1Mit70	a	168bp	SPRET/EiJ
	b	176bp	A/J, AKR/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt
	c	180bp	CAST/EiJ
	d	190bp	BALB/cJ, DBA/2J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit70	a	190bp	BALB/cW, DBA/2W
	D1Mit70	b	176bp	129/SvW, A.CA/W, AKR, BN/aW, C3H/W, C57BL/6W, C57BL/10W, CBA/W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/17/2024 MGI 6.24