About   Help   FAQ
D18Mit8 Primer Detail
Primers
  • Name
    D18Mit8
  • Primer 1 Sequence
    TTTGGAATCTGGCATGTTAC
  • Primer 2 Sequence
    GTCTGAAATGAAGTGCCTGC
  • ID
    MGI:706787
  • Product Size
    77
  • Other IDs
    D18Mit8 (BROAD)
  • Note
    MIT assay: L24
    Additional information: MIT STS Marker Data Files
Genes
D18Mit8 DNA segment, Chr 18, Massachusetts Institute of Technology 8
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D18Mit8 a 71bp A/J, BALB/cJ
b 75bp B6.Cg-Lepob/+, C57BL/6J
c 77bp AKR/J, C3H/HeJ, DBA/2J, LP/J
d 86bp SPRET/EiJ
e 87bp CAST/EiJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D18Mit8 l smaller LG/J
s larger SM/J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/09/2025
MGI 6.24
The Jackson Laboratory