About   Help   FAQ
D18Mit2 Primer Detail
Primers
  • Name
    D18Mit2
  • Primer 1 Sequence
    TTCCCTATCCAGTTGTGTGC
  • Primer 2 Sequence
    CCCCTGTAGCTCAACCCACT
  • ID
    MGI:706789
  • Product Size
    127
  • Other IDs
    D18Mit2 (BROAD)
  • Note
    MIT assay: L9
    Additional information: MIT STS Marker Data Files
Genes
D18Mit2 DNA segment, Chr 18, Massachusetts Institute of Technology 2
Polymorphisms
J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9
Endonuclease Gene Allele Fragments Strains
Not Specified D18Mit2 a largest JF1, MSM/Ms
b smaller C57BL/6, DBA/2
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D18Mit2 a 126bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, NOD/MrkTac, NON/ShiLt
b 131bp LP/J
c 146bp SPRET/EiJ
d 159bp CAST/EiJ
References
J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/09/2025
MGI 6.24
The Jackson Laboratory