D18Mit6 Primer Detail MGI Mouse MGI:706792

D18Mit6 Primer Detail

Name

D18Mit6
Primer 1 Sequence

GATGAGCTAGGAGGAGATATGAGC
Primer 2 Sequence

CATACTTACTACAGGGTTTTGGGC
ID

MGI:706792
Product Size

143
Other IDs

D18Mit6 (BROAD)
Note

MIT assay: A104
Additional information: MIT STS Marker Data Files

D18Mit6

DNA segment, Chr 18, Massachusetts Institute of Technology 6

J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D18Mit6	a	largest	MSM/Ms
Not Specified	D18Mit6	b	smaller	C57BL/6, DBA/2, JF1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D18Mit6	a	124bp	LP/J
	b	128bp	CAST/EiJ
	c	140bp	SPRET/EiJ
	d	142bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, NOD/MrkTac, NON/ShiLt

J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24