About   Help   FAQ
D6Mit57 Primer Detail
Primers
  • Name
    D6Mit57
  • Primer 1 Sequence
    TCTGATATCCAAGTCATCGTGG
  • Primer 2 Sequence
    AAACCAAACAAAAGGAGTGGC
  • ID
    MGI:706842
  • Product Size
    197
  • Other IDs
    D6Mit57 (BROAD)
  • Note
    MIT assay: MPC670
    Additional information: MIT STS Marker Data Files
Genes
D6Mit57 DNA segment, Chr 6, Massachusetts Institute of Technology 57
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D6Mit57 a 196bp 129X1/Sv
f 186, 196bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D6Mit57 a 186bp NOD/MrkTac, NON/ShiLt
b 192bp SPRET/EiJ
c 194bp LP/J
d 196bp AKR/J, B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J
e 198bp A/J, BALB/cJ
f 200bp CAST/EiJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D6Mit57 l smaller LG/J
s larger SM/J
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory