D11Mit188 Primer Detail MGI Mouse MGI:706854

D11Mit188 Primer Detail

Name

D11Mit188
Primer 1 Sequence

CTATTTCCTCAGTGCTCGGC
Primer 2 Sequence

AGCATGTACCTTGAAAACCAGA
ID

MGI:706854
Product Size

126
Other IDs

D11Mit188 (BROAD)
Note

MIT assay: MT1405
Additional information: MIT STS Marker Data Files

DNA segment, Chr 11, Massachusetts Institute of Technology 188

J:40661 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):390-3

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D11Mit188	a	124bp	129P1/ReJ, 129P2/Ola, 129P4/RrRkJ, 129S/SvEv, 129T1/Sv-Dnd1^Ter, 129X1/Sv, 129X1/SvJ, C3HeB/FeJ
		b	122bp	129P3/J
		c	110kb	C57BL/6J

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D11Mit188	a	124bp	129X1/Sv
Not Specified	D11Mit188	b	100, 126bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D11Mit188	a	100bp	NOD/MrkTac
	b	106bp	CAST/EiJ
	c	124bp	AKR/J, NON/ShiLt
	d	126bp	A/J, BALB/cJ, C3H/HeJ, LP/J
	e	128bp	B6.Cg-Lep^ob/+, C57BL/6J
	f	132bp	DBA/2J
	g	156bp	SPRET/EiJ

J:40661 Threadgill DW, et al., Genealogy of the 129 inbred strains: 129/SvJ is a contaminated inbred strain. Mamm Genome. 1997 Jun;8(6):390-3

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24