About   Help   FAQ
D15Mit211 Primer Detail
Primers
  • Name
    D15Mit211
  • Primer 1 Sequence
    ACAAAATACACTCTACCACAATGTG
  • Primer 2 Sequence
    CACAGTATTTAACTTTACAACACACCA
  • ID
    MGI:706896
  • Product Size
    125
  • Other IDs
    D15Mit211 (BROAD)
  • Note
    MIT assay: MJ4504
    Additional information: MIT STS Marker Data Files
Genes
D15Mit211 DNA segment, Chr 15, Massachusetts Institute of Technology 211
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D15Mit211 a 82bp CAST/EiJ
b 112bp SPRET/EiJ
c 128bp A/J, AKR/J, B6.Cg-Lepob/+, LP/J, NOD/MrkTac, NON/ShiLt
d 144bp BALB/cJ, C3H/HeJ
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D15Mit211 a 144bp BALB/cW, C3H/W, CBA/W
b 128bp 129/SvW, A.CA/W, AKR/W, BN/aW, C57BL/6W, C57BL/10W, DBA/2W
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/02/2024
MGI 6.24
The Jackson Laboratory