D15Mit217 Primer Detail MGI Mouse MGI:706902

D15Mit217 Primer Detail

Name

D15Mit217
Primer 1 Sequence

TTGTGTCTTTATCTGGCATTGC
Primer 2 Sequence

GACACATAACGTCTTTACTCTTCTTCC
ID

MGI:706902
Product Size

98
Other IDs

D15Mit217 (BROAD)
Note

MIT assay: MT4900
Additional information: MIT STS Marker Data Files

DNA segment, Chr 15, Massachusetts Institute of Technology 217

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D15Mit217	c	108bp	C3HeB/FeJLe
	D15Mit217	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D15Mit217	a	98bp	AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J
	b	104bp	CAST/EiJ
	c	108bp	A/J, C3H/HeJ, DBA/2J, LP/J, NON/ShiLt

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 08/02/2024 MGI 6.24