D17Mit135 Primer Detail MGI Mouse MGI:706907

D17Mit135 Primer Detail

Name

D17Mit135
Primer 1 Sequence

CATAGATCAGATAGTCGCACGC
Primer 2 Sequence

TCTCAGGAAGGCAGGACAGT
ID

MGI:706907
Product Size

136
Note

MIT assay: MT1720

DNA segment, Chr 17, Massachusetts Institute of Technology 135

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D17Mit135	b	smaller	C57BL/6J
	D17Mit135	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit135	a	91bp	A/J, C3H/HeJ, NOD/MrkTac, NON/ShiLt, SPRET/EiJ
	b	137bp	B6.Cg-Lep^ob/+, C57BL/6J
	c	141bp	CAST/EiJ
	d	149bp	AKR/J, BALB/cJ, DBA/2J, LP/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D17Mit135	a	149bp	129/SvW, A.CA/W, AKR/W, BALB/cW, BN/aW, C3H/W, CBA/W, DBA/2W
	D17Mit135	b	137bp	C57BL/6W, C57BL/10W

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/05/2024 MGI 6.24