D10Mit188 Primer Detail MGI Mouse MGI:706918

D10Mit188 Primer Detail

Name

D10Mit188
Primer 1 Sequence

ATCAAGTACAATCTTTCAAAGCACA
Primer 2 Sequence

TCATCACAGACTCATCTTTTAATTAGG
ID

MGI:706918
Product Size

138
Other IDs

D10Mit188 (BROAD)
Note

MIT assay: MT3991
Additional information: MIT STS Marker Data Files

DNA segment, Chr 10, Massachusetts Institute of Technology 188

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D10Mit188	a	140bp	129X1/Sv
Not Specified	D10Mit188	f	134, 140bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D10Mit188	a	128bp	SPRET/EiJ
	b	132bp	NON/ShiLt
	c	134bp	DBA/2J
	d	136bp	B6.Cg-Lep^ob/+, C57BL/6J, LP/J
	e	138bp	AKR/J, NOD/MrkTac
	f	140bp	A/J, BALB/cJ, C3H/HeJ, CAST/EiJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D10Mit188	c	129bp	CBA/CaOlaHsd
	D10Mit188	s	127bp	SWR/OlaHsd

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/09/2024 MGI 6.24