DXMit170 Primer Detail MGI Mouse MGI:706959

DXMit170 Primer Detail

Name

DXMit170
Primer 1 Sequence

TGCAGGCACTAACAGTGAGG
Primer 2 Sequence

TAGTTTCACTGTGCCATTGTATACA
ID

MGI:706959
Product Size

115
Other IDs

DXMit170 (BROAD)
Note

MIT assay: MTH381
Additional information: MIT STS Marker Data Files

DXMit170

DNA segment, Chr X, Massachusetts Institute of Technology 170

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
DXMit170	a	114bp	AKR/J, DBA/2J, NOD/MrkTac
	b	116bp	B6.Cg-Lep^ob/+, C57BL/6J, NON/ShiLt
	c	122bp	A/J, BALB/cJ, C3H/HeJ, LP/J
	d	124bp	CAST/EiJ
	e	138bp	SPRET/EiJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
DXMit170	b	110bp	C57BL/6JOlaHsd, C57BL/10, SJL/J
	c	116bp	129P3/J, A/JOlaHsd, BALB/cJ, C3H/HeJ
	d	108bp	AKR/OlaHsd, DBA/2J, JF1
	p	94bp	PWB

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24