D11Mit301 Primer Detail MGI Mouse MGI:706972

D11Mit301 Primer Detail

Name

D11Mit301
Primer 1 Sequence

AATAGTCTCATCGGGTTAAACAGC
Primer 2 Sequence

AAGTAGACTGATGTGAGGCTAAGTACC
ID

MGI:706972
Product Size

113
Other IDs

D11Mit301 (BROAD)
Note

MIT assay: MTH596
Additional information: MIT STS Marker Data Files

DNA segment, Chr 11, Massachusetts Institute of Technology 301

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D11Mit301	a	99bp	AKR/J, NOD/MrkTac, NON/ShiLt
	b	113bp	B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, DBA/2J, LP/J
	c	117bp	CAST/EiJ
	d	123bp	SPRET/EiJ
	e	125bp	A/J, C3H/HeJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D11Mit301	a	125bp	A.CA/W, BN/aW, C3H/W, CBA/W
	b	113bp	AKR/W, BALB/cW, C57BL/6W, C57BL/10W, DBA/2W
	c	110bp	129/SvW

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 03/18/2025 MGI 6.24