DXMit136 Primer Detail MGI Mouse MGI:707019

DXMit136 Primer Detail

Name

DXMit136
Primer 1 Sequence

ACGGAAACACTCTTATGTGCG
Primer 2 Sequence

ATTTTGATTACAGCATGTCCCC
ID

MGI:707019
Product Size

182
Other IDs

DXMit136 (BROAD)
Note

MIT assay: MT3951
Additional information: MIT STS Marker Data Files

DXMit136

DNA segment, Chr X, Massachusetts Institute of Technology 136

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	DXMit136	a	194bp	129X1/Sv
Not Specified	DXMit136	f	186bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
DXMit136	a	178bp	CAST/EiJ
	b	180bp	SPRET/EiJ
	c	186bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, NOD/MrkTac, NON/ShiLt
	d	194bp	LP/J

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 08/02/2024 MGI 6.24