DXMit79 Primer Detail MGI Mouse MGI:707043

DXMit79 Primer Detail

Name

DXMit79
Primer 1 Sequence

AGTCTGCCTTCTCTTTCTGTATCC
Primer 2 Sequence

TGAAACTATTCCAACATTATTCTTGG
ID

MGI:707043
Product Size

138
Other IDs

DXMit79 (BROAD)
Note

MIT assay: MTH224
Additional information: MIT STS Marker Data Files

DXMit79

DNA segment, Chr X, Massachusetts Institute of Technology 79

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	DXMit79	c	147bp	C3HeB/FeJLe
	DXMit79	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
DXMit79	a	121bp	SPRET/EiJ
	b	137bp	AKR/J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	c	139bp	B6.Cg-Lep^ob/+, C57BL/6J
	d	143bp	CAST/EiJ
	e	147bp	A/J, BALB/cJ, C3H/HeJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	DXMit79	c	137bp	CBA/CaOlaHsd
	DXMit79	s	142bp	SWR/OlaHsd

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24