About   Help   FAQ
D16Mit79 Primer Detail
Primers
  • Name
    D16Mit79
  • Primer 1 Sequence
    ATCCTGCATGCTTTTGCTCT
  • Primer 2 Sequence
    CAGAGGAGAGTTGTCTGTGTTCC
  • ID
    MGI:707072
  • Product Size
    137
  • Other IDs
    D16Mit79 (BROAD)
  • Note
    MIT assay: MTH128
    Additional information: MIT STS Marker Data Files
Genes
D16Mit79 DNA segment, Chr 16, Massachusetts Institute of Technology 79
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D16Mit79 a 145bp 129X1/Sv
f 151bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D16Mit79 a 135bp B6.Cg-Lepob/+, C57BL/6J
b 137bp BALB/cJ, C3H/HeJ, DBA/2J, LP/J
c 145bp NON/ShiLt
d 149bp SPRET/EiJ
e 151bp A/J, AKR/J, NOD/MrkTac
f 159bp CAST/EiJ
J:71432 Schwarz M, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D15Mit79 a larger 129P3/J
s smaller SJL/J
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/02/2024
MGI 6.24
The Jackson Laboratory