About   Help   FAQ
D16Mit71 Primer Detail
Primers
  • Name
    D16Mit71
  • Primer 1 Sequence
    TAGAAAATCTTCAAATAGGATCTGTTC
  • Primer 2 Sequence
    GAGCATTTCCCTTTTACCTGG
  • ID
    MGI:707075
  • Product Size
    154
  • Other IDs
    D16Mit71 (BROAD)
  • Note
    MIT assay: MPC490
    Additional information: MIT STS Marker Data Files
Genes
D16Mit71 DNA segment, Chr 16, Massachusetts Institute of Technology 71
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D16Mit71 b smaller than f C57BL/6J
c 165bp C3HeB/FeJLe
f larger FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D16Mit71 a 157bp B6.Cg-Lepob/+
b 159bp C57BL/6J, CAST/EiJ
c 163bp A/J, AKR/J, BALB/cJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
d 165bp C3H/HeJ
e 223bp SPRET/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D16Mit71 c 159bp CBA/CaOlaHsd
s 161bp SWR/OlaHsd
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory