D16Mit76 Primer Detail MGI Mouse MGI:707080

D16Mit76 Primer Detail

Name

D16Mit76
Primer 1 Sequence

TTAAGGAGAAAGTAAAAGATACACACA
Primer 2 Sequence

TATTGTTTTCCTGATCAAACATTTG
ID

MGI:707080
Product Size

88
Other IDs

D16Mit76 (BROAD)
Note

MIT assay: MT504
Additional information: MIT STS Marker Data Files

D16Mit76

DNA segment, Chr 16, Massachusetts Institute of Technology 76

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D16Mit76	a	89bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, LP/J
	b	94bp	SPRET/EiJ
	c	108bp	DBA/2J
	d	110bp	NOD/MrkTac
	e	135bp	A/J, BALB/cJ, C3H/HeJ, NON/ShiLt
	f	147bp	CAST/EiJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D16Mit76	a	87bp	AKR/OlaHsd
	b	81bp	129P3/J, C57BL/6JOlaHsd, C57BL/10
	d	101bp	A/JOlaHsd, BALB/cJ, C3H/HeJ, DBA/2J
	j	89bp	JF1
	l	105bp	SJL/J
	p	97bp	PWB

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 08/02/2024 MGI 6.24