D19Mit31 Primer Detail MGI Mouse MGI:707100

D19Mit31 Primer Detail

Name

D19Mit31
Primer 1 Sequence

CAATACAGAGTAATGATTGCCTGA
Primer 2 Sequence

TTCACATTTTGGGATGCTCA
ID

MGI:707100
Product Size

130
Other IDs

D19Mit31 (BROAD)
Note

MIT assay: B547
Additional information: MIT STS Marker Data Files

D19Mit31

DNA segment, Chr 19, Massachusetts Institute of Technology 31

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D19Mit31	b	smaller	C57BL/6J
	D19Mit31	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D19Mit31	a	98bp	SPRET/EiJ
	b	130bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, LP/J
	c	134bp	NON/ShiLt
	d	136bp	C3H/HeJ, DBA/2J
	e	146bp	CAST/EiJ

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/17/2024 MGI 6.24