D8Mit271 Primer Detail MGI Mouse MGI:707110

D8Mit271 Primer Detail

Name

D8Mit271
Primer 1 Sequence

GGCAGAACCACAGGTTGATT
Primer 2 Sequence

GGAATGAGGTTTGGGTCAAA
ID

MGI:707110
Product Size

96
Other IDs

D8Mit271 (BROAD)
Note

MIT assay: MTH411
Additional information: MIT STS Marker Data Files

D8Mit271

DNA segment, Chr 8, Massachusetts Institute of Technology 271

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D8Mit271	a	114bp	129P2/Ola, 129P3/J, 129T1/Sv-Dnd1^Ter, 129X1/Sv
		b	120bp	129X1/SvJ
		c	96, 120bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D8Mit271	a	96bp	B6.Cg-Lep^ob/+, C57BL/6J, NOD/MrkTac, NON/ShiLt
	b	114bp	CAST/EiJ, LP/J
	c	120bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24