About   Help   FAQ
DXMit158 Primer Detail
Primers
  • Name
    DXMit158
  • Primer 1 Sequence
    ATTTGATGCCCTCCTTTGG
  • Primer 2 Sequence
    TTAGCCTGAGCAGAGAAAGACC
  • ID
    MGI:707121
  • Product Size
    129
  • Other IDs
    DXMit158 (BROAD)
  • Note
    MIT assay: MT2847
    Additional information: MIT STS Marker Data Files
Genes
DXMit158 DNA segment, Chr X, Massachusetts Institute of Technology 158
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
DXMit158 a 130bp NOD/MrkTac
b 132bp NON/ShiLt
c 136bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J
d 142bp CAST/EiJ
e 144bp SPRET/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
DXMit158 c 171bp CBA/CaOlaHsd
s 133bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
11/12/2024
MGI 6.24 		The Jackson Laboratory