D18Mit37 Primer Detail MGI Mouse MGI:707146

D18Mit37 Primer Detail

Name

D18Mit37
Primer 1 Sequence

GTGGGGGGGAGAATTGTC
Primer 2 Sequence

ATGAGAGAGCCTATCTCAAACCC
ID

MGI:707146
Product Size

170
Other IDs

D18Mit37 (BROAD)
Note

MIT assay: B565
Additional information: MIT STS Marker Data Files

D18Mit37

DNA segment, Chr 18, Massachusetts Institute of Technology 37

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D18Mit37	m	190bp	MOLF/EiJ
Not Specified	D18Mit37	s	absent	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D18Mit37	a	150bp	SPRET/EiJ
	b	158bp	CAST/EiJ
	c	164bp	A/J, BALB/cJ, C3H/HeJ, DBA/2J
	d	172bp	B6.Cg-Lep^ob/+, C57BL/6J
	e	176bp	AKR/J, LP/J, NON/ShiLt
	f	180bp	NOD/MrkTac

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/05/2024 MGI 6.24