About   Help   FAQ
D5Mit346 Primer Detail
Primers
  • Name
    D5Mit346
  • Primer 1 Sequence
    TCAAACTCCTCTAATATGGAAGTGC
  • Primer 2 Sequence
    CTGTCTCATTAATCCATGGATCC
  • ID
    MGI:707165
  • Product Size
    120
  • Other IDs
    D5Mit346 (BROAD)
  • Note
    MIT assay: MTH1454
    Additional information: MIT STS Marker Data Files
Genes
D5Mit346 DNA Segment, Chr 5, Massachusetts Institute of Technology 346
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D5Mit346 a 114bp CAST/EiJ, NOD/MrkTac
b 120bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, NON/ShiLt
c 140bp BALB/cJ, LP/J
d 146bp SPRET/EiJ
e 174bp A/J, C3H/HeJ, DBA/2J
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D5Mit346 a 121bp AKR/OlaHsd, C57BL/6JOlaHsd, C57BL/10
c 141bp 129P3/J, BALB/cJ
d 177bp A/JOlaHsd, C3H/HeJ, DBA/2J
l 147bp SJL/J
p 113bp JF1, PWB
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D5Mit346 a 174bp A.CA/W, C3H/W, CBA/W, DBA/2W
b 140bp BALB/cW, BN/aW
c 120bp 129/SvW, AKR/W, C57BL/6W, C57BL/10W
J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;
Endonuclease Gene Allele Fragments Strains
D5Mit346 c upper CBA/Kw
e lower KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory