About   Help   FAQ
D12Mit134 Primer Detail
Primers
  • Name
    D12Mit134
  • Primer 1 Sequence
    CTATCTACAACAAACTTCTCCTGGG
  • Primer 2 Sequence
    ACTCAGTCCAAACATATACAAGATGC
  • ID
    MGI:707168
  • Product Size
    184
  • Other IDs
    D12Mit134 (BROAD)
  • Note
    MIT assay: MT498
    Additional information: MIT STS Marker Data Files
Genes
D12Mit134 DNA segment, Chr 12, Massachusetts Institute of Technology 134
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D12Mit134 a 181bp SPRET/EiJ
b 183bp AKR/J, C3H/HeJ, CAST/EiJ
c 185bp B6.Cg-Lepob/+, C57BL/6J, LP/J, NOD/MrkTac
d 187bp BALB/cJ, NON/ShiLt
e 189bp DBA/2J
f 191bp A/J
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D12Mit134 c larger C58/J
f not given FVB/NJ
i larger I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D12Mit134 c 173bp CBA/CaOlaHsd
s 149bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
12/10/2024
MGI 6.24 		The Jackson Laboratory