D1Mit64 Primer Detail MGI Mouse MGI:707178

D1Mit64 Primer Detail

Name

D1Mit64
Primer 1 Sequence

AGTGCATTATGAAGCCCCAC
Primer 2 Sequence

TCAAATTTTAAAACAACCCATTTG
ID

MGI:707178
Product Size

132
Other IDs

D1Mit64 (BROAD)
Note

MIT assay: MPC817
Additional information: MIT STS Marker Data Files

D1Mit64

DNA segment, Chr 1, Massachusetts Institute of Technology 64

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit64	c	114bp	C3HeB/FeJLe
	D1Mit64	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D1Mit64	a	103bp	SPRET/EiJ
	b	114bp	C3H/HeJ
	c	119bp	C57BL/6J
	d	126bp	CAST/EiJ
	e	132bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, DBA/2J, NOD/MrkTac, NON/ShiLt
	f	134bp	LP/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit64	a	132bp	129/SvW, A.CA/W, AKR, BALB/cW, BN/aW, C57BL/6W, C57BL/10W, CBA/W, DBA/2W
	D1Mit64	b	114bp	C3H/W

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/19/2024 MGI 6.24