About   Help   FAQ
D17Mit46 Primer Detail
Primers
  • Name
    D17Mit46
  • Primer 1 Sequence
    TCCACCCCACTACCTGACTC
  • Primer 2 Sequence
    CCCTTCTGATGACCACAGGT
  • ID
    MGI:707200
  • Product Size
    212
  • Other IDs
    D17Mit46 (BROAD)
  • Note
    MIT assay: D578
    Additional information: MIT STS Marker Data Files
Genes
D17Mit46 DNA segment, Chr 17, Massachusetts Institute of Technology 46
Polymorphisms
J:46489 You Y, et al., Mamm Genome. 1998 Mar;9(3):232-4
Notes: Data for C57BL/6J and BALB/cJ strains was derived from the Whitehead Institute/MIT genome center website.
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit46 b 238bp C57BL/6J
s 220bp 129X1/SvJ, BALB/cJ
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit46 a 200bp NON/ShiLt
b 214bp A/J, DBA/2J
c 216bp C3H/HeJ
d 220bp AKR/J, BALB/cJ, LP/J
e 238bp B6.Cg-Lepob/+, C57BL/6J
f 260bp CAST/EiJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D17Mit46 l smaller LG/J
s larger SM/J
References
J:46489 You Y, et al., Utility of C57BL/6J x 129/SvJae embryonic stem cells for generating chromosomal deletions: tolerance to gamma radiation and microsatellite polymorphism. Mamm Genome. 1998 Mar;9(3):232-4
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/02/2024
MGI 6.24
The Jackson Laboratory