D17Mit46 Primer Detail MGI Mouse MGI:707200

D17Mit46 Primer Detail

Name

D17Mit46
Primer 1 Sequence

TCCACCCCACTACCTGACTC
Primer 2 Sequence

CCCTTCTGATGACCACAGGT
ID

MGI:707200
Product Size

212
Other IDs

D17Mit46 (BROAD)
Note

MIT assay: D578
Additional information: MIT STS Marker Data Files

D17Mit46

DNA segment, Chr 17, Massachusetts Institute of Technology 46

J:46489 You Y, et al., Mamm Genome. 1998 Mar;9(3):232-4

Notes: Data for C57BL/6J and BALB/cJ strains was derived from the Whitehead Institute/MIT genome center website.

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit46	b	238bp	C57BL/6J
Not Specified	D17Mit46	s	220bp	129X1/SvJ, BALB/cJ

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit46	a	200bp	NON/ShiLt
	b	214bp	A/J, DBA/2J
	c	216bp	C3H/HeJ
	d	220bp	AKR/J, BALB/cJ, LP/J
	e	238bp	B6.Cg-Lep^ob/+, C57BL/6J
	f	260bp	CAST/EiJ

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D17Mit46	l	smaller	LG/J
	D17Mit46	s	larger	SM/J

J:46489 You Y, et al., Utility of C57BL/6J x 129/SvJae embryonic stem cells for generating chromosomal deletions: tolerance to gamma radiation and microsatellite polymorphism. Mamm Genome. 1998 Mar;9(3):232-4

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24