D17Mit44 Primer Detail MGI Mouse MGI:707202

D17Mit44 Primer Detail

Name

D17Mit44
Primer 1 Sequence

TGGAAGCAGACAGAGGTGG
Primer 2 Sequence

GAAGAGGTGCAGCAGAAACC
ID

MGI:707202
Product Size

153
Note

MIT assay: B419

D17Mit44

DNA segment, Chr 17, Massachusetts Institute of Technology 44

J:46489 You Y, et al., Mamm Genome. 1998 Mar;9(3):232-4

Notes: Data for C57BL/6J and BALB/cJ strains was derived from the Whitehead Institute/MIT genome center website.

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit44	b	152bp	C57BL/6J
Not Specified	D17Mit44	s	154bp	129X1/SvJ, BALB/cJ

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Endonuclease	Gene	Allele	Fragments	Strains
	D17Mit44	a	128bp	CAST/EiJ
	D17Mit44	b	154bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt

J:46489 You Y, et al., Utility of C57BL/6J x 129/SvJae embryonic stem cells for generating chromosomal deletions: tolerance to gamma radiation and microsatellite polymorphism. Mamm Genome. 1998 Mar;9(3):232-4

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24