About   Help   FAQ
D17Mit45 Primer Detail
Primers
  • Name
    D17Mit45
  • Primer 1 Sequence
    GTTGGGACTATGAGGCAAATG
  • Primer 2 Sequence
    CATGCATGTACAATGACACAGTG
  • ID
    MGI:707203
  • Product Size
    221
  • Note
    MIT assay: A1103
Genes
D17Mit45 DNA segment, Chr 17, Massachusetts Institute of Technology 45
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D17Mit45 b larger than f C57BL/6J
c 216bp C3HeB/FeJLe
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit45 a 214bp CAST/EiJ
b 216bp A/J, AKR/J, C3H/HeJ, LP/J
c 220bp BALB/cJ, DBA/2J
d 224bp B6.Cg-Lepob/+
e 226bp C57BL/6J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D17Mit45 c 210bp CBA/CaOlaHsd
s 215bp SWR/OlaHsd
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory