D17Mit45 Primer Detail MGI Mouse MGI:707203

D17Mit45 Primer Detail

Name

D17Mit45
Primer 1 Sequence

GTTGGGACTATGAGGCAAATG
Primer 2 Sequence

CATGCATGTACAATGACACAGTG
ID

MGI:707203
Product Size

221
Note

MIT assay: A1103

D17Mit45

DNA segment, Chr 17, Massachusetts Institute of Technology 45

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Gene	Allele	Fragments	Strains
D17Mit45	b	larger than f	C57BL/6J
	c	216bp	C3HeB/FeJLe
	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit45	a	214bp	CAST/EiJ
	b	216bp	A/J, AKR/J, C3H/HeJ, LP/J
	c	220bp	BALB/cJ, DBA/2J
	d	224bp	B6.Cg-Lep^ob/+
	e	226bp	C57BL/6J

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D17Mit45	c	210bp	CBA/CaOlaHsd
	D17Mit45	s	215bp	SWR/OlaHsd

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24