D1Mit303 Primer Detail MGI Mouse MGI:707208

D1Mit303 Primer Detail

Name

D1Mit303
Primer 1 Sequence

GGTTTCTATTTCGGTTCTCGG
Primer 2 Sequence

TCTGTGCTGCAAAACAGAGG
ID

MGI:707208
Product Size

128
Other IDs

D1Mit303 (BROAD)
Note

MIT assay: MT3244
Additional information: MIT STS Marker Data Files

D1Mit303

DNA segment, Chr 1, Massachusetts Institute of Technology 303

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit303	b	larger	C57BL/6J
	D1Mit303	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D1Mit303	a	98bp	AKR/J, NOD/MrkTac
	b	104bp	CAST/EiJ
	c	114bp	SPRET/EiJ
	d	118bp	A/J, C3H/HeJ, NON/ShiLt
	e	120bp	LP/J
	f	124bp	B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J
	g	130bp	BALB/cJ

J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3

Gene	Allele	Fragments	Strains
D1Mit303	c	not given	C58/J
	f	not given	FVB/NJ
	i	larger	I/LnJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D1Mit303	b	142bp	C57BL/6JOlaHsd
	c	128bp	BALB/cJ, C57BL/10
	d	118bp	129P3/J, A/JOlaHsd, AKR/OlaHsd, C3H/HeJ, DBA/2J, SJL/J
	j	134bp	JF1
	p	104bp	PWB

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit303	c	117bp	CBA/CaOlaHsd
	D1Mit303	s	129bp	SWR/OlaHsd

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/09/2024 MGI 6.24