D8Mit289 Primer Detail MGI Mouse MGI:707211

D8Mit289 Primer Detail

Name

D8Mit289
Primer 1 Sequence

AAAAAGAAAAGAAGGCTTAGTAATGTG
Primer 2 Sequence

CTTGCTATTCATTGCAAAATTCC
ID

MGI:707211
Product Size

149
Other IDs

D8Mit289 (BROAD)
Note

MIT assay: MTH1254
Additional information: MIT STS Marker Data Files

D8Mit289

DNA Segment, Chr 8, Massachusetts Institute of Technology 289

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D8Mit289	a	118bp	C3H/HeJ, DBA/2J
	b	138bp	SPRET/EiJ
	c	152bp	B6.Cg-Lep^ob/+, C57BL/6J
	d	156bp	BALB/cJ, LP/J, NOD/MrkTac, NON/ShiLt
	e	158bp	A/J
	f	168bp	CAST/EiJ

J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;

Endonuclease	Gene	Allele	Fragments	Strains
	D8Mit289	c	upper	CBA/Kw
	D8Mit289	e	lower	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13