D11Mit214 Primer Detail MGI Mouse MGI:707213

D11Mit214 Primer Detail

Name

D11Mit214
Primer 1 Sequence

CATACAGCCTTCAACAATGACA
Primer 2 Sequence

ACTGCATACATGTGCACTCATG
ID

MGI:707213
Product Size

148
Other IDs

D11Mit214 (BROAD)
Note

MIT assay: MT2101
Additional information: MIT STS Marker Data Files

DNA segment, Chr 11, Massachusetts Institute of Technology 214

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D11Mit214	a	131bp	SPRET/EiJ
	b	135bp	A/J, C3H/HeJ, LP/J
	c	147bp	BALB/cJ, NON/ShiLt
	d	149bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, NOD/MrkTac
	e	163bp	CAST/EiJ

J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3

Gene	Allele	Fragments	Strains
D11Mit214	c	not given	C58/J
	f	not given	FVB/NJ
	i	smaller	I/LnJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D11Mit214	d	148bp	129P3/J, AKR/OlaHsd, BALB/cJ, C57BL/6JOlaHsd, C57BL/10, DBA/2J
	l	150bp	SJL/J
	p	164bp	JF1, PWB
	w	134bp	A/JOlaHsd, C3H/HeJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D11Mit214	c	190bp	CBA/CaOlaHsd
	D11Mit214	s	188bp	SWR/OlaHsd

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/05/2024 MGI 6.24