D12Mit263 Primer Detail MGI Mouse MGI:707225

D12Mit263 Primer Detail

Name

D12Mit263
Primer 1 Sequence

TCAGATCTCAGCAGATAAATACTTGG
Primer 2 Sequence

TCCCCTGGAGCATATTTGAC
ID

MGI:707225
Product Size

113
Other IDs

D12Mit263 (BROAD)
Note

MIT assay: MTH915
Additional information: MIT STS Marker Data Files

DNA Segment, Chr 12, Massachusetts Institute of Technology 263

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D12Mit263	a	114bp	B6.Cg-Lep^ob/+, C57BL/6J, LP/J, NOD/MrkTac, SPRET/EiJ
	b	122bp	BALB/cJ, NON/ShiLt
	c	124bp	AKR/J
	d	126bp	C3H/HeJ, DBA/2J
	e	130bp	A/J, CAST/EiJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D12Mit263	a	122bp	AKR/OlaHsd
	b	108bp	C57BL/6JOlaHsd, C57BL/10, SJL/J
	c	118bp	BALB/cJ
	d	124bp	129P3/J, C3H/HeJ, DBA/2J
	j	104bp	JF1
	p	128bp	PWB
	w	132bp	A/JOlaHsd

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24