D8Mit35 Primer Detail MGI Mouse MGI:707279

D8Mit35 Primer Detail

Name

D8Mit35
Primer 1 Sequence

GAGTCCTACAAGTTGTGCCTTG
Primer 2 Sequence

GGAGATAAGGAGACAAGTGTCCC
ID

MGI:707279
Product Size

138
Other IDs

D8Mit35 (BROAD)
Note

MIT assay: A768
Additional information: MIT STS Marker Data Files

D8Mit35

DNA segment, Chr 8, Massachusetts Institute of Technology 35

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D8Mit35	a	132bp	DBA/2J
	b	134bp	C3H/HeJ
	c	138bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, LP/J, NOD/MrkTac, NON/ShiLt
	d	150bp	CAST/EiJ
	e	194bp	SPRET/EiJ

J:66473 Bagella L, et al., J Cell Biochem. 2000 Apr;78(1):170-8

Endonuclease	Gene	Allele	Fragments	Strains
	D8Mit35	a	0.138kb	AEJ/Gn
	D8Mit35	s	0.194kb	M. spretus

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:66473 Bagella L, et al., Genomic organization, promoter analysis, and chromosomal mapping of the mouse gene encoding Cdk9. J Cell Biochem. 2000 Apr;78(1):170-8

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/03/2024 MGI 6.24