D9Mit11 Primer Detail MGI Mouse MGI:707283

D9Mit11 Primer Detail

Name

D9Mit11
Primer 1 Sequence

GCCTTCATGTGTACCTGAATGCAC
Primer 2 Sequence

GGCTCTGTAATCACTGAAGCTGGT
ID

MGI:707283
Product Size

48
Other IDs

D9Mit11 (BROAD)
Note

MIT assay: L60
Additional information: MIT STS Marker Data Files

D9Mit11

DNA segment, Chr 9, Massachusetts Institute of Technology 11

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D9Mit11	c	116bp	C3HeB/FeJLe
	D9Mit11	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D9Mit11	a	74bp	B6.Cg-Lep^ob/+, C57BL/6J
	b	97bp	LP/J
	c	99bp	CAST/EiJ
	d	104bp	DBA/2J
	e	112bp	AKR/J, NOD/MrkTac
	f	114bp	NON/ShiLt
	g	116bp	A/J, BALB/cJ, C3H/HeJ
	h	137bp	SPRET/EiJ

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24