About   Help   FAQ
D17Mit176 Primer Detail
Primers
  • Name
    D17Mit176
  • Primer 1 Sequence
    GCCTAACTAGACTACAAGCCTTGC
  • Primer 2 Sequence
    GTAGGTACATACAACCCACATACAGG
  • ID
    MGI:707308
  • Product Size
    167
  • Other IDs
    D17Mit176 (BROAD)
  • Note
    MIT assay: MT3716
    Additional information: MIT STS Marker Data Files
Genes
D17Mit176 DNA segment, Chr 17, Massachusetts Institute of Technology 176
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit176 a 176bp 129X1/Sv
f 176, 182bp CD-1
J:44833 Meagher S, et al., Hereditas. 1997;127(1-2):75-82
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit176 a smallest A.CA-H2f/Sn
b larger CAST/EiJ
c larger than above RIIIS/J
d larger than above DBA/2J, SJL/J, SWR/J
e larger than above C57BL/6J, M. caroli, SM/J
f larger than above CBA/J, M. spretus
g larger than above P/J
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit176 a 154bp NOD/MrkTac
b 160bp A/J
c 162bp CAST/EiJ, LP/J
d 172bp DBA/2J, NON/ShiLt
e 174bp B6.Cg-Lepob/+, C57BL/6J
f 176bp BALB/cJ
g 182bp AKR/J, C3H/HeJ
h 184bp SPRET/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D17Mit176 c 175bp CBA/CaOlaHsd
s 167bp SWR/OlaHsd
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:44833 Meagher S, et al., A microsatellite-based MHC genotyping system for house mice (Mus domesticus). Hereditas. 1997;127(1-2):75-82
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
12/10/2024
MGI 6.24 		The Jackson Laboratory