D17Mit175 Primer Detail MGI Mouse MGI:707309

D17Mit175 Primer Detail

Name

D17Mit175
Primer 1 Sequence

TGGAAATCGGAGCCTCTG
Primer 2 Sequence

TTGGAAAAGGTTGAGAGTAGATCA
ID

MGI:707309
Product Size

109
Other IDs

D17Mit175 (BROAD)
Note

MIT assay: MT4348
Additional information: MIT STS Marker Data Files

DNA segment, Chr 17, Massachusetts Institute of Technology 175

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit175	a	104bp	129X1/Sv
Not Specified	D17Mit175	f	104, 113bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit175	a	100bp	CAST/EiJ
	b	104bp	BALB/cJ, DBA/2J, LP/J
	c	110bp	B6.Cg-Lep^ob/+, C57BL/6J
	d	113bp	NOD/MrkTac
	e	120bp	NON/ShiLt
	f	122bp	A/J, AKR/J, C3H/HeJ
	g	134bp	SPRET/EiJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D17Mit175	c	120bp	CBA/CaOlaHsd
	D17Mit175	s	118bp	SWR/OlaHsd

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D17Mit175	a	122bp	AKR/W, C3H/W, CBA/W
	b	110bp	A.CA/W, C57BL/6W, C57BL/10W
	c	104bp	129/SvW, BALB/cW, BN/aW, DBA/2W

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24