D10Mit148 Primer Detail MGI Mouse MGI:707316

D10Mit148 Primer Detail

Name

D10Mit148
Primer 1 Sequence

TTCCAGACATACCATCACTATTCTG
Primer 2 Sequence

TTAAGTAGACTCTGTTGCAGAGGTG
ID

MGI:707316
Product Size

132
Other IDs

D10Mit148 (BROAD)
Note

MIT assay: MT1210
Additional information: MIT STS Marker Data Files

DNA segment, Chr 10, Massachusetts Institute of Technology 148

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D10Mit148	a	133bp	129X1/Sv
Not Specified	D10Mit148	f	135, 137bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D10Mit148	a	129bp	LP/J, NON/ShiLt
	b	133bp	BALB/cJ
	c	135bp	CAST/EiJ, DBA/2J
	d	137bp	A/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, NOD/MrkTac
	e	143bp	AKR/J

J:53815 Vacher J, et al., Mamm Genome. 1999 Mar;10(3):239-43

Gene	Allele	Fragments	Strains
D10Mit148	b	0.137kb	C57BL/6J, C57BL/10J, C57BR/cdJ, C57L/J
	g	0.13kb	129T2/SvEms, GL/Le Ostm1^gl/Ostm1^gl
	m	0.095kb	M. m. molossinus
	s	0.080kb	M. spretus

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:53815 Vacher J, et al., Genetic localization and transmission of the mouse osteopetrotic grey-lethal mutation. Mamm Genome. 1999 Mar;10(3):239-43

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24