D15Mit252 Primer Detail MGI Mouse MGI:707371

D15Mit252 Primer Detail

Name

D15Mit252
Primer 1 Sequence

CTTCAAACATGTTATCATTGTCACA
Primer 2 Sequence

CTTCTGTATTCACAGGTGCTCG
ID

MGI:707371
Product Size

121
Other IDs

D15Mit252 (BROAD)
Note

MIT assay: MTH2945
Additional information: MIT STS Marker Data Files

DNA Segment, Chr 15 Massachusetts Institute of Technology 252

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D15Mit252	a	118bp	A/J, BALB/cJ
	b	124bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, NOD/MrkTac
	c	132bp	C3H/HeJ, CAST/EiJ, DBA/2J, LP/J, NON/ShiLt
	d	140bp	SPRET/EiJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D15Mit252	a	120bp	AKR/OlaHsd, C57BL/6JOlaHsd, C57BL/10, JF1
	c	114bp	129P3/J, A/JOlaHsd, BALB/cJ, C3H/HeJ, SJL/J
	d	128bp	DBA/2J
	p	140bp	PWB

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D15Mit252	c	larger	CBA/Kw
	D15Mit252	e	smaller	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24