About   Help   FAQ
D14Mit95 Primer Detail
Primers
  • Name
    D14Mit95
  • Primer 1 Sequence
    TATTTTTAAGTCAGTATACACATGCGC
  • Primer 2 Sequence
    TTATCCAAGTGTATTTAAAGAAGAGGC
  • ID
    MGI:707400
  • Product Size
    124
  • Other IDs
    D14Mit95 (BROAD)
  • Note
    MIT assay: MPC2351
    Additional information: MIT STS Marker Data Files
Genes
D14Mit95 DNA segment, Chr 14, Massachusetts Institute of Technology 95
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D14Mit95 a 169bp 129X1/Sv
f 125bp CD-1
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D14Mit95 b smaller than f C57BL/6J
c 129bp C3HeB/FeJLe
f larger FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D14Mit95 a 117bp SPRET/EiJ
b 125bp NON/ShiLt
c 129bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J
d 137bp CAST/EiJ
e 169bp DBA/2J, LP/J, NOD/MrkTac
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory

Building initial tooltip...