D14Mit98 Primer Detail MGI Mouse MGI:707403

D14Mit98 Primer Detail

Name

D14Mit98
Primer 1 Sequence

TCTTAAATACTCACTCTGTGGTGAGG
Primer 2 Sequence

CTCCATGAAGCACCCACAC
ID

MGI:707403
Product Size

150
Other IDs

D14Mit98 (BROAD)
Note

MIT assay: MT717
Additional information: MIT STS Marker Data Files

D14Mit98

DNA segment, Chr 14, Massachusetts Institute of Technology 98

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D14Mit98	a	168bp	129X1/Sv
Not Specified	D14Mit98	f	164, 168bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D14Mit98	a	146bp	C3H/HeJ, DBA/2J, LP/J
	b	150bp	B6.Cg-Lep^ob/+
	c	152bp	BALB/cJ, C57BL/6J
	d	161bp	CAST/EiJ
	e	164bp	A/J, AKR/J, NOD/MrkTac, NON/ShiLt

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24