D18Mit135 Primer Detail MGI Mouse MGI:707410

D18Mit135 Primer Detail

Name

D18Mit135
Primer 1 Sequence

GGCCTCTCTCTGAACGTGAC
Primer 2 Sequence

GAACTACATAGATACAAATGAGCCTCC
ID

MGI:707410
Product Size

130
Other IDs

D18Mit135 (BROAD)
Note

MIT assay: MT2894
Additional information: MIT STS Marker Data Files

DNA segment, Chr 18, Massachusetts Institute of Technology 135

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D18Mit135	m	110bp	MOLF/EiJ
Not Specified	D18Mit135	s	135bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D18Mit135	a	83bp	SPRET/EiJ
	b	93bp	C57BL/6J
	c	115bp	CAST/EiJ
	d	121bp	C3H/HeJ, NOD/MrkTac, NON/ShiLt
	e	135bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, DBA/2J, LP/J

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/19/2024 MGI 6.24