About   Help   FAQ
D18Mit187 Primer Detail
Primers
  • Name
    D18Mit187
  • Primer 1 Sequence
    TGCTTGAAGAAAGAGATCCTACG
  • Primer 2 Sequence
    GACATGCATGCCTGTAACTCC
  • ID
    MGI:707431
  • Product Size
    118
  • Other IDs
    D18Mit187 (BROAD)
  • Note
    MIT assay: MT5266
    Additional information: MIT STS Marker Data Files
Genes
D18Mit187 DNA segment, Chr 18, Massachusetts Institute of Technology 187
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D18Mit187 a 100bp C3H/HeJ, DBA/2J
b 106bp CAST/EiJ, SPRET/EiJ
c 114bp A/J, BALB/cJ, NOD/MrkTac, NON/ShiLt
d 118bp B6.Cg-Lepob/+, C57BL/6J, LP/J
e 140bp AKR/J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D18Mit187 a 140bp AKR/W
b 118bp 129/SvW, C57BL/10W
c 114bp A.CA/W, BALB/cW, BN/aW, C57BL/6W
d 100bp C3H/W, CBA/W, DBA/2W
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/12/2024
MGI 6.13
The Jackson Laboratory