D18Mit187 Primer Detail MGI Mouse MGI:707431

D18Mit187 Primer Detail

Name

D18Mit187
Primer 1 Sequence

TGCTTGAAGAAAGAGATCCTACG
Primer 2 Sequence

GACATGCATGCCTGTAACTCC
ID

MGI:707431
Product Size

118
Other IDs

D18Mit187 (BROAD)
Note

MIT assay: MT5266
Additional information: MIT STS Marker Data Files

DNA segment, Chr 18, Massachusetts Institute of Technology 187

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D18Mit187	a	100bp	C3H/HeJ, DBA/2J
	b	106bp	CAST/EiJ, SPRET/EiJ
	c	114bp	A/J, BALB/cJ, NOD/MrkTac, NON/ShiLt
	d	118bp	B6.Cg-Lep^ob/+, C57BL/6J, LP/J
	e	140bp	AKR/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D18Mit187	a	140bp	AKR/W
	b	118bp	129/SvW, C57BL/10W
	c	114bp	A.CA/W, BALB/cW, BN/aW, C57BL/6W
	d	100bp	C3H/W, CBA/W, DBA/2W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24