D16Mit38 Primer Detail MGI Mouse MGI:707484

D16Mit38 Primer Detail

Name

D16Mit38
Primer 1 Sequence

GGGAGGTAGACTAGCAACATGG
Primer 2 Sequence

AATGAAATACACATACCCACATGC
ID

MGI:707484
Product Size

183
Other IDs

D16Mit38 (BROAD)
Note

MIT assay: MPC286
Additional information: MIT STS Marker Data Files

D16Mit38

DNA segment, Chr 16, Massachusetts Institute of Technology 38

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D16Mit38	b	larger	C57BL/6J
	D16Mit38	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D16Mit38	a	178bp	C3H/HeJ
	b	180bp	AKR/J, CAST/EiJ, NOD/MrkTac
	c	184bp	B6.Cg-Lep^ob/+, C57BL/6J
	d	186bp	A/J, BALB/cJ, DBA/2J, NON/ShiLt

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24