D14Mit165 Primer Detail MGI Mouse MGI:707493

D14Mit165 Primer Detail

Name

D14Mit165
Primer 1 Sequence

TGTACATTAAATTTGGAAACCTGG
Primer 2 Sequence

ACTACACTTTCAGCATAAGACACACA
ID

MGI:707493
Product Size

134
Other IDs

D14Mit165 (BROAD)
Note

MIT assay: MT2220
Additional information: MIT STS Marker Data Files

DNA segment, Chr 14, Massachusetts Institute of Technology 165

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D14Mit165	c	121bp	C3HeB/FeJLe
	D14Mit165	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D14Mit165	a	121bp	A/J, AKR/J, BALB/cJ, C3H/HeJ
	b	134bp	LP/J
	c	135bp	SPRET/EiJ
	d	136bp	B6.Cg-Lep^ob/+, C57BL/6J, NOD/MrkTac
	e	146bp	CAST/EiJ
	f	151bp	DBA/2J
	g	160bp	NON/ShiLt

J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3

Gene	Allele	Fragments	Strains
D14Mit165	c	larger	C58/J
	f	not given	FVB/NJ
	i	not given	I/LnJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D14Mit165	c	124bp	CBA/CaOlaHsd
	D14Mit165	s	136bp	SWR/OlaHsd

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D14Mit165	a	151bp	DBA/2W
	b	136bp	C57BL/6W, C57BL/10W
	c	121bp	129/SvW, A.CA/W, AKR/W, BALB/cW, BN/aW, C3H/W, CBA/W

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/09/2024 MGI 6.24