D4Mit234 Primer Detail MGI Mouse MGI:707546

D4Mit234 Primer Detail

Name

D4Mit234
Primer 1 Sequence

TTGTAATCCTCTCCCTTTAAAACA
Primer 2 Sequence

AACCCTGGACAGCAAGTCC
ID

MGI:707546
Product Size

148
Note

MIT assay: MTH208

D4Mit234

DNA segment, Chr 4, Massachusetts Institute of Technology 234

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D4Mit234	a	153bp	129X1/Sv
Not Specified	D4Mit234	f	115, 141bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D4Mit234	a	111bp	CAST/EiJ
	b	115bp	NOD/MrkTac
	c	129bp	DBA/2J
	d	133bp	SPRET/EiJ
	e	141bp	AKR/J, C3H/HeJ, NON/ShiLt
	f	153bp	A/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J
	g	161bp	LP/J

J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3

Gene	Allele	Fragments	Strains
D4Mit234	c	not given	C58/J
	f	not given	FVB/NJ
	i	larger	I/LnJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D4Mit234	c	230bp	CBA/CaOlaHsd
	D4Mit234	s	249bp	SWR/OlaHsd

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D4Mit234	a	153bp	129/SvW, A.CA/W, BALB/cW, C57BL/6W, C57BL/10W
	b	141bp	AKR/W, C3H/W, CBA/W
	c	129bp	BN/aW, DBA/2W

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 08/02/2024 MGI 6.24