D19Mit75 Primer Detail MGI Mouse MGI:707562

D19Mit75 Primer Detail

Name

D19Mit75
Primer 1 Sequence

CTTCCTCTGCTTGTGTGAAGG
Primer 2 Sequence

ACACAAACATTTTACACATGACCC
ID

MGI:707562
Product Size

97
Other IDs

D19Mit75 (BROAD)
Note

MIT assay: MT3195
Additional information: MIT STS Marker Data Files

D19Mit75

DNA segment, Chr 19, Massachusetts Institute of Technology 75

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D19Mit75	m	100bp	MOLF/EiJ
Not Specified	D19Mit75	s	132bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D19Mit75	a	92bp	LP/J
	b	94bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, NON/ShiLt
	c	96bp	B6.Cg-Lep^ob/+, NOD/MrkTac
	d	112bp	CAST/EiJ
	e	114bp	SPRET/EiJ

J:61322 Montgomery JC, et al., MGI Direct Data Submission. 2000;

Endonuclease	Gene	Allele	Fragments	Strains
	D19Mit75	a	105bp	AEJ/Gn
	D19Mit75	s	114bp	M. spretus

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:61322 Montgomery JC, et al., Chromosomal localization of the mouse G protein-coupled receptor kinase 5 and 6 genes. MGI Direct Data Submission. 2000;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24