D13Mit76 Primer Detail MGI Mouse MGI:707624

D13Mit76 Primer Detail

Name

D13Mit76
Primer 1 Sequence

ATGCACCTGTCTAAATGTGTGC
Primer 2 Sequence

AGAGGGACTGTGGGACTGTG
ID

MGI:707624
Product Size

109
Other IDs

D13Mit76 (BROAD)
Note

MIT assay: MPC1025
Additional information: MIT STS Marker Data Files

D13Mit76

DNA segment, Chr 13, Massachusetts Institute of Technology 76

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D13Mit76	b	larger	C57BL/6J
	D13Mit76	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D13Mit76	a	88bp	C3H/HeJ, NON/ShiLt
	b	90bp	NOD/MrkTac
	c	98bp	AKR/J, BALB/cJ, DBA/2J, LP/J, SPRET/EiJ
	d	106bp	B6.Cg-Lep^ob/+, C57BL/6J
	e	118bp	CAST/EiJ

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24