D18Mit55 Primer Detail MGI Mouse MGI:707657

D18Mit55 Primer Detail

Name

D18Mit55
Primer 1 Sequence

ACAGATGTTCCCCAGCATTC
Primer 2 Sequence

TGAGTGTGAGATCAGCCTGTG
ID

MGI:707657
Product Size

159
Other IDs

D18Mit55 (BROAD)
Note

MIT assay: MPC1430
Additional information: MIT STS Marker Data Files

D18Mit55

DNA segment, Chr 18, Massachusetts Institute of Technology 55

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D18Mit55	a	124bp	SPRET/EiJ
	b	152bp	A/J, DBA/2J
	c	158bp	CAST/EiJ
	d	160bp	B6.Cg-Lep^ob/+, C57BL/6J
	e	166bp	AKR/J, BALB/cJ, C3H/HeJ, LP/J, NOD/MrkTac, NON/ShiLt

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D18Mit55	a	167bp	AKR/OlaHsd
	b	157bp	C57BL/6JOlaHsd, C57BL/10
	c	163bp	129P3/J, BALB/cJ, C3H/HeJ
	d	149bp	A/JOlaHsd, DBA/2J, SJL/J
	j	159bp	JF1
	p	153bp	PWB

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24